View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8443_low_23 (Length: 251)
Name: NF8443_low_23
Description: NF8443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8443_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 88 - 245
Target Start/End: Original strand, 1155306 - 1155463
Alignment:
| Q |
88 |
cctaattaccttagcgatgttaaggtagaagaagagaggcttcttagtcttggaaacttgaatacgatagatcttcttctctttctcgatctcgccgcca |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1155306 |
cctaattaccttagcgatgttaaggtagaagaagagtggcttcttagtcttggaaacttgaatacgatagatcttcttctctttctcgatctcgccgcca |
1155405 |
T |
|
| Q |
188 |
ttgatcttcacattcttcgtcgcaccggttagaactgcaatcgcttctttcatctcac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1155406 |
ttgatcttcacattcttcgtcgcaccggttagaactgcaatcgcttctttcatctcac |
1155463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 1155219 - 1155260
Alignment:
| Q |
1 |
gtttctgaatcagaaagaaacacgaaattcataatcagaaat |
42 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1155219 |
gtttctgaatcagaaagaaacacgaaatccataatcagaaat |
1155260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University