View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8444_high_3 (Length: 244)
Name: NF8444_high_3
Description: NF8444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8444_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 669981 - 669766
Alignment:
| Q |
1 |
cgataactcacgatgggttatgggtaatgcgcgtggtacttctttttggtatgataattgggtaggcaacgtgcctttaaaggtcaggtttcctagactt |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
669981 |
cgataactcacgataggttatgggtaatgggcgtggtacttctttttggtatgataattgggtaggcaacgtgcctttaaaggtcaggtttcctagactt |
669882 |
T |
|
| Q |
101 |
tttgacttgacggtggatagagaggcattggttgtggatatggcgactagagggtggagaagggggaaacgcttggagatggaggagatgccttttagcg |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
669881 |
tttgacttgacggtggat--agaggcattggtggtggatatggcgactagagggtggggaagggggaaaggcttggagatggaggagacgccttttagcg |
669784 |
T |
|
| Q |
201 |
tgagaggaggagagtgtg |
218 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
669783 |
tgagaggaggagaatgtg |
669766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 36844851 - 36844632
Alignment:
| Q |
1 |
cgataactcacgatgggttatgggtaatgcgcgtggtacttctttttggtatgataattgggtaggcaacgtgcctttaaaggtcaggtttcctagactt |
100 |
Q |
| |
|
||||||||| ||| ||||| ||||||||| ||| || |||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||| || |
|
|
| T |
36844851 |
cgataactcgcgacgggttgtgggtaatggacgtagtgcttctttttggtatgataattgggtaggcaacatgcctttaagggtcaagtttcctagattt |
36844752 |
T |
|
| Q |
101 |
tttgacttgacggtggatagagaggcattggttgtggatatggcgactagagggt--ggagaagggggaaacgcttggagatggaggagatgccttttag |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||| |||||||| || || ||||| ||||| |||||||||| ||||||| |||| |||| |
|
|
| T |
36844751 |
tttgacttaacggtggatagagaggcattggtggtggatatggtgactagagagtggggggaaggaggaaatgcttggagatcgaggagacgcctcttag |
36844652 |
T |
|
| Q |
199 |
cgtgagaggaggagagtgtg |
218 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
36844651 |
tgtgggaggaggagagtgtg |
36844632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University