View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8445_high_5 (Length: 348)
Name: NF8445_high_5
Description: NF8445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8445_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 6 - 314
Target Start/End: Original strand, 35113596 - 35113912
Alignment:
| Q |
6 |
agtagcagagaaaccattgaaagtgcaaaattggattcttccataatgcctggtcttataactga--------tatctctcgatgctcggtttgtgtact |
97 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35113596 |
agtatcagtgaaaccattgaaagtgcaaaattggattcttccataatgcctggtcttataactgattttctgatatctctcgatgctcggtttgtgtact |
35113695 |
T |
 |
| Q |
98 |
tcatgaattggttgcatggtgatataagacaatataacatcgaggaccctaaacatcctatgttgactggccaagtatggtttggtggacagttccagaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35113696 |
tcatgaattggttgcatggtgatataagacaatataacatcgaggaccctaaacatcctatgttgactggccaagtatggtttggtggacagttccagaa |
35113795 |
T |
 |
| Q |
198 |
aggaagctctatagttgtcacaacagaagatggtaatacttggcaatcttatgttccatacattcaggttagtgctacgtaattttttgaactatatgtc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35113796 |
aggaagctctatagttgtcacaacagaagatggtaatacttggcaatcttatgttccatacattcaggttagtgctacgtaattttttgaactatatgtc |
35113895 |
T |
 |
| Q |
298 |
tagtcttgagcgtgagg |
314 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35113896 |
tagtcttgagcgtgagg |
35113912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University