View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8445_high_6 (Length: 309)
Name: NF8445_high_6
Description: NF8445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8445_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 187 - 302
Target Start/End: Original strand, 34174072 - 34174187
Alignment:
| Q |
187 |
ttggtgagaatgctttaataatttgtttatgatagacaatcagtttttctctccattcaatgaattcaattccttccattcaacgtccccttcattttag |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34174072 |
ttggtgagaatgctttaataatttgtttatgatagacaatcagtttttctctccattcaatgaattcaattccttccattcaacgtccccttcattttag |
34174171 |
T |
 |
| Q |
287 |
gacacaggttctgctc |
302 |
Q |
| |
|
||| ||| || ||||| |
|
|
| T |
34174172 |
gacccagattttgctc |
34174187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 34173907 - 34173968
Alignment:
| Q |
20 |
gtgatggccagtgccatcgatatcacacatcaaatgttcatccacataagtttgccacgaca |
81 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34173907 |
gtgatgaccagtgccatcgatatcacacatcaaatgttcatccacataagtttgccacgaca |
34173968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 43051461 - 43051410
Alignment:
| Q |
30 |
gtgccatcgatatcacacatcaaatgttcatccacataagtttgccacgaca |
81 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
43051461 |
gtgccatcaatatcacacatcaaatgttcatcaacgtaagtttgccacgaca |
43051410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University