View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8445_high_9 (Length: 232)

Name: NF8445_high_9
Description: NF8445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8445_high_9
NF8445_high_9
[»] chr1 (2 HSPs)
chr1 (160-213)||(52002556-52002609)
chr1 (160-215)||(5174751-5174806)


Alignment Details
Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 160 - 213
Target Start/End: Complemental strand, 52002609 - 52002556
Alignment:
160 tcatcagcaatcgaactttgtttttcgtccttaaccaagtattataagcatatt 213  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
52002609 tcatcagcaattgaactttgtttttcgtccttaaccaagtattataagcatatt 52002556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 215
Target Start/End: Complemental strand, 5174806 - 5174751
Alignment:
160 tcatcagcaatcgaactttgtttttcgtccttaaccaagtattataagcatattcc 215  Q
    ||||||||||| ||| |||||||||| ||||||||||| ||| |||||||||||||    
5174806 tcatcagcaattgaagtttgtttttcatccttaaccaaatataataagcatattcc 5174751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University