View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8445_low_11 (Length: 210)
Name: NF8445_low_11
Description: NF8445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8445_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 2355744 - 2355568
Alignment:
| Q |
16 |
atgaacatttgcatcaataagggtttgcattcatttgatattcggttgtgtgattgatttagaacttgcttaatgatgttattttctccaacaaatgttt |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355744 |
atgaacatttgcatcaataagggttcacattcatttgatattcggttgtgtgattgatttagaacttgcttaatgatgttattttctccaacaaatgttt |
2355645 |
T |
 |
| Q |
116 |
agtaattggtgaattagataaagttctcctataaaccgtggtttttgggtagcactatcaagctttgatgtatctac |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
2355644 |
agtaattggtgaattagataaagttctcctataaaccgtggtttttgggtagaactatcaagctttcatgtatctac |
2355568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University