View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8445_low_7 (Length: 287)
Name: NF8445_low_7
Description: NF8445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8445_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 54 - 278
Target Start/End: Complemental strand, 31839650 - 31839426
Alignment:
| Q |
54 |
aagtttaaagaatgataatatttatataaataagttctaataaaccaaatgaaaaatattagattttacttgttttttcaaaaagcagaaaataatgtca |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| | |
|
|
| T |
31839650 |
aagtttaaagaatgataatatttatataaataagttctaataaaccaaatgaaaaatattagattttacttgcttttttaaaaagcagaaaataatgtta |
31839551 |
T |
 |
| Q |
154 |
ttttatatggttatatacatttaaagcatcgtatgattgagggtacgtaggtttcatctttcgccaacgattattgatctagttgataaatatttgactt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31839550 |
ttttatatggttatatacatttaaagcatcgtatgattgagggtacgtaggtttcatctttcgccaacgattattgatctagttgataaatatttgactt |
31839451 |
T |
 |
| Q |
254 |
taccctacaatccatttcatctcat |
278 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
31839450 |
taccctacaatccatttcatttcat |
31839426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University