View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8446_high_4 (Length: 240)
Name: NF8446_high_4
Description: NF8446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8446_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 32860895 - 32861106
Alignment:
| Q |
17 |
agtattggaccttgctcacttgttaacaaaggttttaataagaaaatgcgaaaaacacagatgtattttagcagctgatggcagcaacaatttatatgta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860895 |
agtattggaccttgctcacttgttaacaaaggttttaataagaaaatgcgaaaaacacagatgtattttagcagctgatggcagcaacaatttatatgta |
32860994 |
T |
 |
| Q |
117 |
actgatcccattttctcaatgactgggaagggaccgaagtagcataaacaagtttctgattgcggctcaatgacaccatgttgatgagaaggctataatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
32860995 |
actgatcccattttctcaatgactgggaagggaccgaagtagcataaacaagtttctgattacggctcagtgacaccatgttgacgagaaggctataatt |
32861094 |
T |
 |
| Q |
217 |
taaccaacacca |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32861095 |
taaccaacacca |
32861106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University