View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8446_high_4 (Length: 240)

Name: NF8446_high_4
Description: NF8446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8446_high_4
NF8446_high_4
[»] chr5 (1 HSPs)
chr5 (17-228)||(32860895-32861106)


Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 32860895 - 32861106
Alignment:
17 agtattggaccttgctcacttgttaacaaaggttttaataagaaaatgcgaaaaacacagatgtattttagcagctgatggcagcaacaatttatatgta 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32860895 agtattggaccttgctcacttgttaacaaaggttttaataagaaaatgcgaaaaacacagatgtattttagcagctgatggcagcaacaatttatatgta 32860994  T
117 actgatcccattttctcaatgactgggaagggaccgaagtagcataaacaagtttctgattgcggctcaatgacaccatgttgatgagaaggctataatt 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||    
32860995 actgatcccattttctcaatgactgggaagggaccgaagtagcataaacaagtttctgattacggctcagtgacaccatgttgacgagaaggctataatt 32861094  T
217 taaccaacacca 228  Q
    ||||||||||||    
32861095 taaccaacacca 32861106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University