View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8447_high_3 (Length: 246)
Name: NF8447_high_3
Description: NF8447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8447_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 46312406 - 46312162
Alignment:
| Q |
1 |
ttgtgaggccaaaacataactatcttggattgtaaaccctgtgctttgatgtggacttttcctaccttgagctgtgattgtaaccttttgtaatggaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46312406 |
ttgtgaggccaaaacataactatcttggattgtaaaccctgtgctttgatgtggacttttcctaccttgagctgtgattgtaaccttttgtaatggaagt |
46312307 |
T |
 |
| Q |
101 |
ggaactcttgtgtatatcttgcagttttgtagcacagcagctccattgccaaaaatgaagtctatggttccatagatttcgcattcacggtagaactgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46312306 |
ggaactcttgtgtatatcttgcagttttgtagcacagcagctccattgccaaaaatgaagtctatggttccatagatttcgcattcacggtagaactgtc |
46312207 |
T |
 |
| Q |
201 |
tcagtgaatgtgcgtaaagtgtgtcttggtttccttctatgctac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46312206 |
tcagtgaatgtgcgtaaagtgtgtcttggtttccttctatgctac |
46312162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University