View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8448_high_16 (Length: 252)
Name: NF8448_high_16
Description: NF8448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8448_high_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 10 - 252
Target Start/End: Complemental strand, 38412769 - 38412505
Alignment:
| Q |
10 |
tgagatgaatgatgttgcaattaaattcatttccatctcgtaatt-acttacttgctgctaggtttggatttttatattaatccttaa------------ |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38412769 |
tgagatgaatgatgttgcaattaaattcatttccatctcgtaatttacttacttgctgctaggtttggatttttatattaatccttaatttttttttttg |
38412670 |
T |
 |
| Q |
97 |
---------ggttccatatatgttttgttatttcctatgaagagttggacacatgtgtgtttgtgtcaaacaccgatgctacatgggtgatttcttatat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38412669 |
aaagattaaggttccatatatgttttgttatttcctatgaagagttggacacatgtgtgtttgtgtcaaacaccgatgctacatgggtgatttcttatct |
38412570 |
T |
 |
| Q |
188 |
ctttgttaaaatcagtttattgcttagtaattatctttactgtgaatcataactagacattatct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38412569 |
ctttgttaaaatcagtttattgcttagtaattatctttactgcgaatcataactagacattatct |
38412505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University