View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8448_high_20 (Length: 230)
Name: NF8448_high_20
Description: NF8448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8448_high_20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 24557363 - 24557134
Alignment:
| Q |
1 |
tataatgggatttgggtaaaccattctttagaaatctatgcctgcagataatagcccattgttcattggatgtcaacaatttccaagtcagcaaaagcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24557363 |
tataatgggatttgggtaaaccattctttagaaatctatgcctgcagataatagcccattgttcattggatgtcaacaatttccaagtcagcaaaagcat |
24557264 |
T |
 |
| Q |
101 |
ggctgctttatttgttttaataggatctctgatagaaagacctccttcctctctaggtttacaaattgttgcccaagccacaatgcagatcnnnnnnnga |
200 |
Q |
| |
|
| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
24557263 |
gactgctttatttgttttaacaggatctctgatagaaagaccttcttcctctctaggtttacaaattgttgcccaagccacagtgcagatctttttttga |
24557164 |
T |
 |
| Q |
201 |
tcaataccaccactccaaaggaagtttctc |
230 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
24557163 |
tcaatactaccactccaaaggaagtttctc |
24557134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University