View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8448_high_21 (Length: 229)

Name: NF8448_high_21
Description: NF8448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8448_high_21
NF8448_high_21
[»] chr2 (1 HSPs)
chr2 (1-214)||(24556682-24556895)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 24556895 - 24556682
Alignment:
1 gtttgaatccagtgatggaagctattacatgagctctggatagagatgtgcccccaatgtaaaatttactttttgaagcatttatcaattgcctagaata 100  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
24556895 gtttgaatctagtgatggaagctattacatgagctctggatagagatgtgcccccaatgtaaaatttactttttgaagaatttatcaattgcctagaata 24556796  T
101 ctgaccataaagatgaaagagctgcttgatatgccatatgttacttagagttcctttgcaacaaacaagtatgtcatctgcatagagacaatgactggga 200  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||    
24556795 ctgaccataaagaggaaagagctgcttgatatgccatatgttacttagagttcctttgcaaaaaacaagtatgtcatctgcgtagagacaatgactggga 24556696  T
201 atgaagagagattt 214  Q
    ||||||||||||||    
24556695 atgaagagagattt 24556682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University