View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8448_high_6 (Length: 405)
Name: NF8448_high_6
Description: NF8448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8448_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 15 - 387
Target Start/End: Complemental strand, 46851824 - 46851452
Alignment:
| Q |
15 |
gagaaaaacataggtatcaattcatcacctcaaaaaattgaaacattgtaaacaagttcaacctgaatttctactcaaaatcaacaattaaacataaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46851824 |
gagaaaaacataggtatcaattcatcacctcaaaaaattgaaacattgtaaacaagttcaacctgaatttctactcaaaatcaataattaaacataaaaa |
46851725 |
T |
 |
| Q |
115 |
gcgcaatgaaagacacggaatttgacaagttcttcggaggagaattatcaattttacttaccggttcgagatcctagtaatgagtcgctatcatcgatgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46851724 |
gcgcaatgaaagacacggaatttgacaagttcttcggaggagaattatcaattttacttaccggttcgagatcctagtaatgagtcgctatcatcgatgt |
46851625 |
T |
 |
| Q |
215 |
tgagtcggaaagcggatgccgacctcggaatgataccggacatttcagtttccggcggattccgatgagttctcccccggcggtattgcggtaaacgagc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| | |
|
|
| T |
46851624 |
tgagtcggaaagcggatgccgacctcggaatgataccggacatttcagtttccggcggattccgatgagttcttccccggcggtattgcggtgaacgaac |
46851525 |
T |
 |
| Q |
315 |
aacgaacggcgaggtgtagaaattgggaaattttgagggcaataacggtattaaagacaaaatatacacacaa |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46851524 |
aacgaacggcgaggtgtagaaattgggaaattttgagggcaataacggtattaaagacaaaatatacacacaa |
46851452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University