View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8448_low_29 (Length: 237)

Name: NF8448_low_29
Description: NF8448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8448_low_29
NF8448_low_29
[»] chr1 (2 HSPs)
chr1 (133-223)||(17079987-17080077)
chr1 (1-68)||(17080142-17080208)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 17080077 - 17079987
Alignment:
133 aaacaaacctttacttcaaggtttcatttatgtactatgaatgcactagaatccaattgatcaggatgtattaacttccagaacagaataa 223  Q
    ||||||| ||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||    
17080077 aaacaaaacttaacttcaaggtttcatttatgtactatgactgcactagaaaccaattgatcaggatgtattaacttccagaacagaataa 17079987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 17080208 - 17080142
Alignment:
1 caatcacaagcattcttctctctccccatcccctttaaaaattctctcccaaacaaggtgagaaaata 68  Q
    |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
17080208 caatcacaagcaatcttctctctccccatcccctttaaaaattctct-ccaaacaaggtgagaaaata 17080142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University