View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8448_low_29 (Length: 237)
Name: NF8448_low_29
Description: NF8448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8448_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 17080077 - 17079987
Alignment:
| Q |
133 |
aaacaaacctttacttcaaggtttcatttatgtactatgaatgcactagaatccaattgatcaggatgtattaacttccagaacagaataa |
223 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17080077 |
aaacaaaacttaacttcaaggtttcatttatgtactatgactgcactagaaaccaattgatcaggatgtattaacttccagaacagaataa |
17079987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 17080208 - 17080142
Alignment:
| Q |
1 |
caatcacaagcattcttctctctccccatcccctttaaaaattctctcccaaacaaggtgagaaaata |
68 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17080208 |
caatcacaagcaatcttctctctccccatcccctttaaaaattctct-ccaaacaaggtgagaaaata |
17080142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University