View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8448_low_33 (Length: 229)
Name: NF8448_low_33
Description: NF8448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8448_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 24556895 - 24556682
Alignment:
| Q |
1 |
gtttgaatccagtgatggaagctattacatgagctctggatagagatgtgcccccaatgtaaaatttactttttgaagcatttatcaattgcctagaata |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24556895 |
gtttgaatctagtgatggaagctattacatgagctctggatagagatgtgcccccaatgtaaaatttactttttgaagaatttatcaattgcctagaata |
24556796 |
T |
 |
| Q |
101 |
ctgaccataaagatgaaagagctgcttgatatgccatatgttacttagagttcctttgcaacaaacaagtatgtcatctgcatagagacaatgactggga |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24556795 |
ctgaccataaagaggaaagagctgcttgatatgccatatgttacttagagttcctttgcaaaaaacaagtatgtcatctgcgtagagacaatgactggga |
24556696 |
T |
 |
| Q |
201 |
atgaagagagattt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24556695 |
atgaagagagattt |
24556682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University