View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8448_low_36 (Length: 205)
Name: NF8448_low_36
Description: NF8448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8448_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 37549014 - 37548842
Alignment:
| Q |
16 |
atgaagacagaacaaacaaacctatccttgatgaattcccttaactatctaggaattacaacataaaacattgaatcaaaactctcattgccttgcagtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37549014 |
atgaagacagaacaaacaaacctatccttgatgaattcccttaactatctaggaattacaacaaaaaacattgaatcaaaactctcattgccttgcagtt |
37548915 |
T |
|
| Q |
116 |
ggcacattgaatcattaatttcttataaacatggtaacagcaaatagcatgaattttctaacaggattgaaat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37548914 |
ggcacattgaatcattaatttcttataaacatggtaacagcaaatagcatgaattttctaacaggattgaaat |
37548842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University