View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8449_low_19 (Length: 334)
Name: NF8449_low_19
Description: NF8449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8449_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 6e-68; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 181 - 319
Target Start/End: Complemental strand, 2785644 - 2785506
Alignment:
| Q |
181 |
attgaacataagaaaataactaagctcactttcccagaaatgattgtagtaactttaaaacaagcacaccctaaacattatcttttctcaacgtgaggac |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2785644 |
attgaacataagaaaataactaagctcactttcccagaaatgattgtagtaactttaaaacaagcacaccctaaacattatcttttctcaacgtgaggac |
2785545 |
T |
 |
| Q |
281 |
gttgatttaatggctcaggcgtttatggttaattgtttt |
319 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
2785544 |
gttgatttaatgtctcaggtgtttatggttaattgtttt |
2785506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 28 - 138
Target Start/End: Complemental strand, 2785797 - 2785688
Alignment:
| Q |
28 |
cttgcttgtctttaaatttccattggttttgtcttaaagtttcttgagcttagtttttggcctcttgaatgatactttcttattattgctcttccacact |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2785797 |
cttgtttgtctttaaatttccattggttttgtcttaaagtttcttgagctca-tttttggcctcttgaatgatactttcttattattgctcttccacact |
2785699 |
T |
 |
| Q |
128 |
tgaaagaacaa |
138 |
Q |
| |
|
||||||||||| |
|
|
| T |
2785698 |
tgaaagaacaa |
2785688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 36 - 134
Target Start/End: Original strand, 27741179 - 27741276
Alignment:
| Q |
36 |
tctttaaatttccattggttttgtcttaaagtttcttgagcttagtttttggcctcttgaatgatactttcttattattgctcttccacacttgaaaga |
134 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
27741179 |
tcttcaaatttccattggttttgtcttagagtttcttgagctta-ttcttggcctcttgaatgatattttcttattgttgctcttccacacttgtaaga |
27741276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 70
Target Start/End: Complemental strand, 19288856 - 19288814
Alignment:
| Q |
28 |
cttgcttgtctttaaatttccattggttttgtcttaaagtttc |
70 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
19288856 |
cttgcttgtctttaaatttctattggttttgtcttagagtttc |
19288814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University