View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8449_low_22 (Length: 253)
Name: NF8449_low_22
Description: NF8449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8449_low_22 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 4323955 - 4324207
Alignment:
| Q |
1 |
cgtgtctatattggtgcttcatagatcaagagtgttcatgtttgttttgtgagcactggattataaattcaatattattggaagggcgattttatcatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4323955 |
cgtgtctatattggtgcttcatagatcaagagtgttcatgtttgttttgtgagcactggattataaattcaatattattggaagggcgattttatcatgc |
4324054 |
T |
 |
| Q |
101 |
tttcttaacatataattttctttgtttcttgcagcttatcaaggaattgggggctccagttgaatacattgtcctccctactttcgcctacgagcacaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4324055 |
tttcttaacatataattttctttgtttcttgcagcttatcaaggaattgggggctccagttgaatacattgtcctccctactttcgcctacgagcacaaa |
4324154 |
T |
 |
| Q |
201 |
atatttgtcggtccgttttcaagaaaatttccgcgtgctcaggtatgggtggc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4324155 |
atatttgtcggtccgttttcaagaaaatttccgcgtgctcaggtatgggtggc |
4324207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University