View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8449_low_23 (Length: 241)
Name: NF8449_low_23
Description: NF8449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8449_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 4324624 - 4324846
Alignment:
| Q |
1 |
ttaatctttgtaagtaaagaatgaaaagtctcatttgcttatttctttaggaattgggccatatgtggaggttgctttctaccacaagccttcaaggaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4324624 |
ttaatctttgtaagtaaagaatgaaaagtctcatttgcttatttctttaggaattgggccatatgtggaggttgctttctaccacaagccttcaaggaca |
4324723 |
T |
|
| Q |
101 |
ttattggtgacagatgctgttattcttgtaccaaaacagccacccgtgtgtattaacaaagaatcccttttagcatctgcaaaaaatggtttggctgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4324724 |
ttattggtgacagatgctgttattcttgtaccgaaacagccacccgtgtgtattaacaaagaatcccttttagcatctgcaaaaaatggtttggctgtaa |
4324823 |
T |
|
| Q |
201 |
agattcttagcaagggaaaagag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4324824 |
agattcttagcaagggaaaagag |
4324846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University