View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8449_low_26 (Length: 240)
Name: NF8449_low_26
Description: NF8449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8449_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 52442614 - 52442415
Alignment:
| Q |
18 |
aaatcatacatttttgttttgtttatgtttcatattggaattgaaaatctagatccttgcattagtgttacaacactttcacacttcacccatctcacac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
52442614 |
aaatcatacatttttgttttgtttatgtttcatattggaattgaacatctagatccttgcattagtgttacaacactttcac--ttcacccatcacacac |
52442517 |
T |
 |
| Q |
118 |
tctaacatacatactccattcactctaatttatatgttattttaggaatatatcttttgcctaatttttagtgtaattatgtaatatgaatactgataag |
217 |
Q |
| |
|
|||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52442516 |
tctaacatac----tccatccactctaatttacatgttattttaggaatatatcttttgcctaatttttagtgtaattatgtaatacgaatactgataag |
52442421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University