View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8449_low_30 (Length: 230)
Name: NF8449_low_30
Description: NF8449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8449_low_30 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 89 - 230
Target Start/End: Original strand, 52442277 - 52442416
Alignment:
| Q |
89 |
aggcgtataaagtaataaaatatttctgtaccacttgtaagtggacacaacatttagaaagaacaatagtaatttgtacnnnnnnnnnnnncacaatagt |
188 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52442277 |
aggcgtataaagtaataaaatatttttgtaccacttgtaagtggacacaacatttagaaagaacaatagtaatttgtac--aaaaaaaaaacacaatagt |
52442374 |
T |
 |
| Q |
189 |
tatggtgatgttaatgtgtaagttctataaaaagtaataata |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52442375 |
tatggtgatgttaatgtgtaagttctataaaaagtaataata |
52442416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 52442189 - 52442223
Alignment:
| Q |
1 |
tttacatatgttttattgtgctagtaaatagtatg |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52442189 |
tttacatatgttttattgtgctagtaaatagtatg |
52442223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University