View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8449_low_33 (Length: 225)
Name: NF8449_low_33
Description: NF8449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8449_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 90 - 214
Target Start/End: Complemental strand, 428167 - 428043
Alignment:
| Q |
90 |
tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
428167 |
tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag |
428068 |
T |
|
| Q |
190 |
tatttgatcccaaactccaaactcg |
214 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
428067 |
tatttgatcccaaacttcaaactcg |
428043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University