View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8449_low_34 (Length: 223)
Name: NF8449_low_34
Description: NF8449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8449_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 31 - 207
Target Start/End: Complemental strand, 26057581 - 26057404
Alignment:
| Q |
31 |
atggatgaactgctcaatgacagtggaaatacactgttgaaccatgataccctggcccctcattgaggcatcatccatttcttcctcactgttctttctc |
130 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
26057581 |
atggatgaactgcttaatgacagtggaaatacactgttgaaccatgataccctggcccctcattgaggcatcatccatttctttctcaccgttctttctc |
26057482 |
T |
|
| Q |
131 |
-ttattaactgacaaagttgagcaagtcaccattttacaagtacacaaccaaatatgcttaaaagtttcaagtataat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
26057481 |
tttattaactgacaaagttgagcaagtcaccattttacaagtacataaccaaatttgcttaaaagtttcaagtataat |
26057404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University