View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8449_low_5 (Length: 524)
Name: NF8449_low_5
Description: NF8449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8449_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 188 - 442
Target Start/End: Complemental strand, 20370128 - 20369871
Alignment:
| Q |
188 |
cctgagcgatgataccagtgggtaagtgtttaaggcgaacagcagattcacgtttgttacgatgctgaccaccaggaccagaggttttgaatgtacccat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20370128 |
cctgagcgatgataccagtgggtaagtgtttaaggcgaacagcagattcacgtttgttacgatgctgaccaccaggaccagaggttttgaatgtacccat |
20370029 |
T |
|
| Q |
288 |
ttcgcactgtcgcattaggtcatcgtcggttaggtctagataaccgccgtgatttgcggtggcggcggcgg---tggttattggtgttgtggagtggagt |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20370028 |
ttcgcactgtcgcattaggtcatcgtcggttaggtctagataaccgccgtgatttgcggtggcggcggcggtggtggttattggtgttgtggagtggagt |
20369929 |
T |
|
| Q |
385 |
gagattgggcgaattttgatggtaaaaaatggatgatggagaaagtggcagtgggaaa |
442 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
20369928 |
gagattgggcgaattttgatgttgaaaaatggatgatggagaaagtggcagtgggaaa |
20369871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 52 - 135
Target Start/End: Complemental strand, 20370264 - 20370181
Alignment:
| Q |
52 |
gtccagtgttgaagtctgtgtccgtggttcctaagccgggaataattggtgtttaatttttatcgggactaaattgacccggcc |
135 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20370264 |
gtccagtgtcgaagtctgtgtccgtgcttcctaagccgggaataattggtgtttaatttttatcgggactaaattgacccggcc |
20370181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University