View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8449_low_7 (Length: 410)
Name: NF8449_low_7
Description: NF8449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8449_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 7e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 7e-96
Query Start/End: Original strand, 19 - 259
Target Start/End: Original strand, 30250798 - 30251041
Alignment:
| Q |
19 |
cttctagtaaggtttggttaattgaattgtttaaaataattcatgaaattttattttgttggaattcaacaattatccacataacatagatacaaatcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30250798 |
cttctagtaaggtttggttaattgaattgtttaaaataattcatgaaattttattttgctggaattcaacaattatccacatatcatagatacaaatcat |
30250897 |
T |
|
| Q |
119 |
aacatattcatattaaaatagatcaaaaggatttgtt---cnnnnnnnnttatcatataaagaatttgtttcaaaataatccagagcttggatatggtgg |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30250898 |
aacatattcatattgaaatagatcaaaagaatttgtttaaaaaaaaaaattatcatataaagaatttgtttcaaaataatccagaacttggatatggtgg |
30250997 |
T |
|
| Q |
216 |
ccaaatccatgtgacttatacgatgtcccttcattccctcgtcg |
259 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30250998 |
ccaaatccatgtgacttatacaatgtcccttcattccctcgtcg |
30251041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University