View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8450_high_9 (Length: 276)
Name: NF8450_high_9
Description: NF8450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8450_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 65 - 262
Target Start/End: Complemental strand, 34453369 - 34453172
Alignment:
| Q |
65 |
tccaaaaccaaagtatttcatttggtttctattaatggtgtactcgatctctcatatgtttaggaatgactttatctttaatttgatcaaccaatttttt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34453369 |
tccaaaaccaaagtatttcatttggtttctattaatggtgtattcgatctctcatatatttaggaatgactttatctttaatttgatcaaccaatttttt |
34453270 |
T |
 |
| Q |
165 |
cttagtttggagacaccaatattttggtcgatttttgtgattgataactctgtatcttttttatattggcacttcttgtgatttgattgtttgtttct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34453269 |
cttagtttggagacaccaatattttggtcgatttttgtgattgataactctgtatcttttttatattggcacttcttgtgatttgattgtttgtttct |
34453172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University