View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8450_low_10 (Length: 315)
Name: NF8450_low_10
Description: NF8450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8450_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 148 - 296
Target Start/End: Original strand, 7646166 - 7646316
Alignment:
| Q |
148 |
atatttaattttgttt-gtcctctaagttttcattgttaatttatttgtcttagtaatgnnnnnnnn-tgatcatatgaatctaaattggctccttggat |
245 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| |
|
|
| T |
7646166 |
atatttaatttttttttgtcctctaagttttcattgttaatttatttgtcttagtaatgaaaaaaaaatgaacatatgaatctaaattggctccttcgat |
7646265 |
T |
 |
| Q |
246 |
taaaaataacacatcaattaatttatttatcgttgatgcctagcacaaata |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7646266 |
taaaaataacacatcaattaatttatttatcgttgatgcctagcacaaata |
7646316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 17 - 60
Target Start/End: Original strand, 7646038 - 7646081
Alignment:
| Q |
17 |
gacatcacatcccttcacaatattaatccatctcagaacacata |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7646038 |
gacatcacatcccttcacaatattaatccatctcagaacacata |
7646081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University