View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8451_low_7 (Length: 296)
Name: NF8451_low_7
Description: NF8451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8451_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 63 - 277
Target Start/End: Complemental strand, 20016544 - 20016330
Alignment:
| Q |
63 |
ctgtttaattttatctacagaaatcctagggtcaggatttgaatccaacatcttacacaatagcttccctaaaaatattgggaaacaatttggacactta |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20016544 |
ctgtttaattttatctacagaaatcctagggttaggatttgaatccaacatcttacacaatagcttccctaaaaatattgggaaacaatttggacactta |
20016445 |
T |
 |
| Q |
163 |
aactctgctttgcttatcttcatgtaataaaccatcaagaaactgaataaattagatatgataagtccctaaaaatgggaattgaaaataatatagtgtc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20016444 |
aactctgctttgcttatcttcatgtaataaaccatcaagaaactgaataaattagatatgataagtccctaaaaatgggaattgaaaataacatagtgtc |
20016345 |
T |
 |
| Q |
263 |
atggtacttacagat |
277 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20016344 |
atggtacttacagat |
20016330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 206 - 274
Target Start/End: Complemental strand, 20026852 - 20026784
Alignment:
| Q |
206 |
tgaataaattagatatgataagtccctaaaaatgggaattgaaaataatatagtgtcatggtacttaca |
274 |
Q |
| |
|
|||||||| |||| || | |||||||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
20026852 |
tgaataaactagagataacaagtccctaaaaatgggaattgaatataatgtagtgtcacagtacttaca |
20026784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 64 - 183
Target Start/End: Complemental strand, 31892963 - 31892844
Alignment:
| Q |
64 |
tgtttaattttatctacagaaatcctagggtcaggatttgaatccaacatcttacacaatagcttccctaaaaatattgggaaa-caatttggacactta |
162 |
Q |
| |
|
|||||||| ||||| | ||||||||||| ||||||||||| |||||||||||||| || || ||| | ||| | | || ||||| ||||| || |||||| |
|
|
| T |
31892963 |
tgtttaatcttatcgatagaaatcctagtgtcaggatttggatccaacatcttacccagtaactt-cttaacatttttcggaaaccaattagggcactta |
31892865 |
T |
 |
| Q |
163 |
aactctgctttgcttatcttc |
183 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
31892864 |
aactctgctttacttatcttc |
31892844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 73 - 122
Target Start/End: Complemental strand, 31898453 - 31898404
Alignment:
| Q |
73 |
ttatctacagaaatcctagggtcaggatttgaatccaacatcttacacaa |
122 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| || ||||||| ||||||| |
|
|
| T |
31898453 |
ttatctatagaaatcctagtgtcaggatttggatgcaacatcctacacaa |
31898404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University