View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8452_high_4 (Length: 363)
Name: NF8452_high_4
Description: NF8452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8452_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 90 - 333
Target Start/End: Complemental strand, 31352972 - 31352729
Alignment:
| Q |
90 |
caggaatggacataaatattctactatgaacttccaaagatagcccgaacttagctagactatctgcaacttggttggcctctctcacaacatggcttat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31352972 |
caggaatggacataaatattctactatgaacttcgaaagatagcccgaacttagctagactatctgcaacttggttggcctctctcacaacatggcttat |
31352873 |
T |
 |
| Q |
190 |
tttaacataatcaagatccacatcaactcttcaatattcctgtccaaactgtggcaagtctgggtcagcacacaacctgagttgattgtattaactgcta |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31352872 |
tttaacataatcaagatccacatcaactcttcaatattcctgtccaaactgtggcaagtctgggtcagcacacaacctgagttgattgtattaactgcta |
31352773 |
T |
 |
| Q |
290 |
aaaagaatccgattctaacaacaaatgctttaatcctttctctt |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31352772 |
aaaagaatccgattctaacaacaaatgctttaatcctttctctt |
31352729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 31353055 - 31353008
Alignment:
| Q |
7 |
taaattaccacaacactttaacggaagattggaaccctacatcctcga |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31353055 |
taaattaccacaacactttaacggaagattggaaccctacatcctcga |
31353008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 203
Target Start/End: Original strand, 10217199 - 10217261
Alignment:
| Q |
141 |
tagctagactatctgcaacttggttggcctctctcacaacatggcttattttaacataatcaa |
203 |
Q |
| |
|
||||||||||||| || |||||||| |||||||||| ||||||| | ||||| |||| ||||| |
|
|
| T |
10217199 |
tagctagactatccgccacttggttagcctctctcaaaacatggttaattttgacatgatcaa |
10217261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University