View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8452_high_5 (Length: 331)
Name: NF8452_high_5
Description: NF8452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8452_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 125 - 315
Target Start/End: Complemental strand, 43315821 - 43315633
Alignment:
| Q |
125 |
acaactcgatgatactaaaataattttttatgcnnnnnnnnnnnnnttgtatggctaaataggatggattgaagggggtgctcattattgttatttacta |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43315821 |
acaactcgatgatactaaaataattttttatgcaaaaaaagaaa--ttgtatggctaaataggatggattgaagggggtgctcattattgttatttacta |
43315724 |
T |
 |
| Q |
225 |
cgatagcctgtcattgataaatgacttctctagtagattttcgttatgggaaagtaattgagatgagacttaattggctgcatttatttat |
315 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43315723 |
cgattgcctgtcattgataaatgacttctctagtagattttcgttatgggaaagtaattgagatgggacttaattggctgcatttatttat |
43315633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 15 - 46
Target Start/End: Complemental strand, 43315932 - 43315901
Alignment:
| Q |
15 |
ccaacatttcgaaggtaagatttttgccctcc |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43315932 |
ccaacatttcgaaggtaagatttttgccctcc |
43315901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University