View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8452_low_7 (Length: 331)

Name: NF8452_low_7
Description: NF8452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8452_low_7
NF8452_low_7
[»] chr3 (2 HSPs)
chr3 (125-315)||(43315633-43315821)
chr3 (15-46)||(43315901-43315932)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 125 - 315
Target Start/End: Complemental strand, 43315821 - 43315633
Alignment:
125 acaactcgatgatactaaaataattttttatgcnnnnnnnnnnnnnttgtatggctaaataggatggattgaagggggtgctcattattgttatttacta 224  Q
    |||||||||||||||||||||||||||||||||             ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43315821 acaactcgatgatactaaaataattttttatgcaaaaaaagaaa--ttgtatggctaaataggatggattgaagggggtgctcattattgttatttacta 43315724  T
225 cgatagcctgtcattgataaatgacttctctagtagattttcgttatgggaaagtaattgagatgagacttaattggctgcatttatttat 315  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
43315723 cgattgcctgtcattgataaatgacttctctagtagattttcgttatgggaaagtaattgagatgggacttaattggctgcatttatttat 43315633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 15 - 46
Target Start/End: Complemental strand, 43315932 - 43315901
Alignment:
15 ccaacatttcgaaggtaagatttttgccctcc 46  Q
    ||||||||||||||||||||||||||||||||    
43315932 ccaacatttcgaaggtaagatttttgccctcc 43315901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University