View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8453_low_4 (Length: 240)
Name: NF8453_low_4
Description: NF8453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8453_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 21 - 167
Target Start/End: Original strand, 34568159 - 34568305
Alignment:
| Q |
21 |
aaaaataatgatttgcgtacatctataacctctcaaccttatgacttacctttgtgaaaaactctttgtaaactgcaggatgattttaaaaacaacatta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
34568159 |
aaaaataatgatttgcgtacatctataacctctcaaccttatgacttacctttgtgaaaaactctttgtaaactgcgggatgattttaaaagcaacatta |
34568258 |
T |
|
| Q |
121 |
tttggcaaatagggaatggaaacgtcaatttttggttgaataaatgg |
167 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
34568259 |
tttggcaaataggaaatgcaaacgtcaatttttggttgaataaatgg |
34568305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 230
Target Start/End: Original strand, 34568314 - 34568348
Alignment:
| Q |
196 |
tcacaactatttcatatttggacactactcttcat |
230 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
34568314 |
tcacgactatttcatatttggacactactcttcat |
34568348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 24 - 142
Target Start/End: Complemental strand, 4815050 - 4814933
Alignment:
| Q |
24 |
aataatgatttgcgtacatctataacctctcaaccttatgacttacctttgtgaaaaactctttgtaaactgcaggatgattttaaaaacaacattattt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||| || |||||||||| ||| | ||||||||| |
|
|
| T |
4815050 |
aataatgatttgcgtacatctataacctctcaaccttatgactcacctttgtggaaagctctttgtaaagtgtgggatgattttcaaagc-acattattt |
4814952 |
T |
|
| Q |
124 |
ggcaaatagggaatggaaa |
142 |
Q |
| |
|
|||||||| || ||||||| |
|
|
| T |
4814951 |
ggcaaataagggatggaaa |
4814933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University