View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8455_high_11 (Length: 231)
Name: NF8455_high_11
Description: NF8455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8455_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 24014161 - 24013939
Alignment:
| Q |
1 |
cctgagcatgtattgaaagctttaggggtattcatctaatgaccaaaccatttaatctccaaattttgatgtggatccttttcaattttaatttgattgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24014161 |
cctgagcatgtattgaaagctttaggggtattcatctaatgaacaaaccatttaatctccaaattttgatgtggatccttttcaattttaatttgattgc |
24014062 |
T |
 |
| Q |
101 |
ttatattatacgccctcttcttggacgttctgtgcattgatttgtatctttctcatgtggatccttttcaatggtgttattcttgatttttctttgcatt |
200 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24014061 |
ttatataatacgctctcttcttggacgttctgtgcattgatttgtatctttctcatgtggatccttttcaatggtgttattcttgatttttctttgcatt |
24013962 |
T |
 |
| Q |
201 |
gtagttgggtttgatgtccatct |
223 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
24013961 |
gtagttgggtttgatggccatct |
24013939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University