View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8455_low_5 (Length: 392)
Name: NF8455_low_5
Description: NF8455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8455_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 8e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 14 - 95
Target Start/End: Original strand, 7308187 - 7308268
Alignment:
| Q |
14 |
attattcttatatacgttttttaagggattcttatacgttgtaatccgaaagtaaaagtatgatacaattggaatctttaaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
7308187 |
attattcttatatacgttttttaagggattcttatacgttgtaatccgaaagtaaaagtataatacagttggaatctttaaa |
7308268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University