View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8457_high_8 (Length: 229)
Name: NF8457_high_8
Description: NF8457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8457_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 190
Target Start/End: Original strand, 27145494 - 27145677
Alignment:
| Q |
7 |
gagtgagatgaatgactgaatcataatttagatacttattctctctaatctcaaatataaacaacaaaaaatcatatttgatggtctcaaacataaacaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27145494 |
gagtgagatgaatgactgaatcataatttagatacttattctctctaatctcaaatataaacaacaaaaaatcatatttgatggtctcaaacataagcaa |
27145593 |
T |
|
| Q |
107 |
aggttaactaactcaactaattaaatattaaaaatgctaagatcatctgcgatagagctcctattttttgttgcttaagcctta |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
27145594 |
aggttaactaactcaactaattaaatattaaaaatgctaagatcatctgcgatagagctcctatttttgggtgcttaagcctta |
27145677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University