View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8458_high_6 (Length: 351)

Name: NF8458_high_6
Description: NF8458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8458_high_6
NF8458_high_6
[»] chr1 (1 HSPs)
chr1 (183-339)||(38792730-38792886)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 1e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 183 - 339
Target Start/End: Complemental strand, 38792886 - 38792730
Alignment:
183 gatatattggaccttaaattaaactaataagctgttttgttatatcaggaagtctatgctgtctcacaaggtgacaaaagaagttggaaaaagctagcaa 282  Q
    ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38792886 gatatattggaccttgaattaaactaataagttgttttgttatatcaggaagtctatgctgtctcacaaggtgacaaaagaagttggaaaaagctagcaa 38792787  T
283 cnnnnnnntatccaaaatcacttattttccacgatggaagactagccctaacaccaa 339  Q
    |       || ||||||||||||||||||||||||||||||||||||||||||||||    
38792786 caaaaaaatacccaaaatcacttattttccacgatggaagactagccctaacaccaa 38792730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University