View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8458_high_6 (Length: 351)
Name: NF8458_high_6
Description: NF8458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8458_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 1e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 183 - 339
Target Start/End: Complemental strand, 38792886 - 38792730
Alignment:
| Q |
183 |
gatatattggaccttaaattaaactaataagctgttttgttatatcaggaagtctatgctgtctcacaaggtgacaaaagaagttggaaaaagctagcaa |
282 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38792886 |
gatatattggaccttgaattaaactaataagttgttttgttatatcaggaagtctatgctgtctcacaaggtgacaaaagaagttggaaaaagctagcaa |
38792787 |
T |
 |
| Q |
283 |
cnnnnnnntatccaaaatcacttattttccacgatggaagactagccctaacaccaa |
339 |
Q |
| |
|
| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38792786 |
caaaaaaatacccaaaatcacttattttccacgatggaagactagccctaacaccaa |
38792730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University