View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8459_high_5 (Length: 355)
Name: NF8459_high_5
Description: NF8459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8459_high_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 190 - 355
Target Start/End: Original strand, 42691868 - 42692035
Alignment:
| Q |
190 |
tggtttttccacttgttatttcacttggtgggatcttgcaaaacattgtatatgtgatgatttttaccgtaatcaattttgatatgnnnnnnnnatacca |
289 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42691868 |
tggtttttccagttgttatttcacttgatgggatcttgcaaaacattgtatatgtgatgatttttaccgtaatcaattttgatatattttttttatacca |
42691967 |
T |
 |
| Q |
290 |
ctttcgttcatttttc--tatggattttggtctagtcttccacccccaccaatgttttttcctctttt |
355 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42691968 |
ctttcgttcatttttctatatggattttggtctagtcttccacccccaccaatgttttttcctctttt |
42692035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 2 - 155
Target Start/End: Original strand, 2432363 - 2432515
Alignment:
| Q |
2 |
aaatgggttatgttaaaactacccaacgaatctgagttaattactgcccatgccactagcnnnnnnnncaaaacaattgcaacctgttatactgggtaaa |
101 |
Q |
| |
|
||||| ||||||| |||| | || ||| ||| ||||||| |||||||||||||||||| | |||||||||||||||| ||||| | |||||| |
|
|
| T |
2432363 |
aaatgagttatgtcaaaaatgccaaacaaatgtgagttatttactgcccatgccactaacaaaaaaa-caaaacaattgcaaccggttattcctggtaaa |
2432461 |
T |
 |
| Q |
102 |
agacggtggaccatggatggaccttaaatattaaggaccatactaggggctccc |
155 |
Q |
| |
|
| || | ||||||||| |||||||||||||||| |||||||| ||| ||||||| |
|
|
| T |
2432462 |
aaacaggggaccatgggtggaccttaaatattagggaccatattagaggctccc |
2432515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 112 - 155
Target Start/End: Original strand, 55160764 - 55160807
Alignment:
| Q |
112 |
ccatggatggaccttaaatattaaggaccatactaggggctccc |
155 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
55160764 |
ccatgggtggaccttaaatattaagaaccatactaagggctccc |
55160807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University