View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8460_low_13 (Length: 242)
Name: NF8460_low_13
Description: NF8460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8460_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 58 - 233
Target Start/End: Complemental strand, 21959346 - 21959171
Alignment:
| Q |
58 |
aaagactaaactttacttggtggactgaagcatatggaagcaatattgcatgcattattcggagttactcattttggcatttcttctataaataaacttt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21959346 |
aaagactaaactttacttggtggactgaagcatatggaagcaatattgcatgcattatttggagttactctttttggcatttcttctataaataaacttt |
21959247 |
T |
|
| Q |
158 |
ttgtcatggattggtggtggtcagtgggtaattgtgttccccagttttgattttagaggtcagaagttgttcatct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21959246 |
ttgtcatggattggtggtggtcagtgggtaattgtgttccctagttttgattttagaggtcagaagttgttcatct |
21959171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 21959531 - 21959482
Alignment:
| Q |
17 |
aaaagttaacataaatgaatgacatacattttgattaaagtaaagactaa |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21959531 |
aaaagttaacataaatgaatgacatacattttgatcaaagtaaagactaa |
21959482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University