View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8460_low_15 (Length: 227)
Name: NF8460_low_15
Description: NF8460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8460_low_15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 16344699 - 16344480
Alignment:
| Q |
1 |
caacttggtgatggtcataaaattaatttttggacagatgattggtgtggatcccctttggttgacttgcttcatattccccataatctgcacaataatc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
16344699 |
caacttagtgatggtcataaaattaatttttggacagatgattggtgtggatcccctttggttgacttgcttcatatttcccataatctgcacaat---c |
16344603 |
T |
|
| Q |
101 |
tgcagtccaaagtgaatgatttcatccaattctcaatggcatgttccaatggagttgcagctagcctatccatccttaattcaccatattaataaaatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16344602 |
tgcagtccaaagtgaatgatttcatccaattctcaatggcatgttccaatggagttgcagctagcctatccatccttaatgcaccatattaataaaat-- |
16344505 |
T |
|
| Q |
201 |
ctcactattccttggaggcataaagct |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
16344504 |
--cactattccttggaggcataaagct |
16344480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 141
Target Start/End: Complemental strand, 12043762 - 12043624
Alignment:
| Q |
4 |
cttggtgatggtcataaaattaatttttggacagatgattggtgtggatcccctttggttgacttgcttcatattccccataatctgcacaataatctgc |
103 |
Q |
| |
|
||||||||||| || || || || || ||||| |||||||||||||| |||| ||| |||| ||| |||||||||||||||| ||||| ||||||| | |
|
|
| T |
12043762 |
cttggtgatggccaaaagatcaacttctggactcatgattggtgtggaacccccttg-ttgatttgtttcatattccccataacctgcatcataatcttc |
12043664 |
T |
|
| Q |
104 |
agtccaaagtgaatgatttcatc--caattctcaatggca |
141 |
Q |
| |
|
|| | ||||||||| | |||| ||||||||||||||| |
|
|
| T |
12043663 |
tctctacagtgaatgactacatcatcaattctcaatggca |
12043624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University