View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8460_low_17 (Length: 201)
Name: NF8460_low_17
Description: NF8460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8460_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 17 - 184
Target Start/End: Original strand, 46752532 - 46752699
Alignment:
| Q |
17 |
taatactagctgatacagttgttaatgaagctactgatattttgttttattctaaattctaaaagatcttttttcagctaaattttatataaataaatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752532 |
taatactagctgatacagttgttaatgaagctgctgatattttgttttattctaaattctaaaagatcttttttcagctaaattttatataaataaatct |
46752631 |
T |
|
| Q |
117 |
atcaatcttttagatttttgtgggtgcaatcttaccagaacccttcatctttgtgacatcatgcatgt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752632 |
atcaatcttttagatttttgtgggtgcaatcttaccagaacccttcatctttgtgacatcatgcatgt |
46752699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University