View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8460_low_5 (Length: 368)
Name: NF8460_low_5
Description: NF8460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8460_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 350
Target Start/End: Complemental strand, 37118776 - 37118443
Alignment:
| Q |
1 |
agtgagagggagattgcttcttttactctcagactagagaatattacaataaatcttgtatcattgcaagtgtactaaagagaacttgattaatgtacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37118776 |
agtgagagggagattgcttcttttactctgagactagagaatattacaataaatcttgtatcattgcaagtgtactgaagagaacttgattaatgtacac |
37118677 |
T |
|
| Q |
101 |
atgctcttataactcttcgtagaagagannnnnnnnnnctacctagattcaagttcatgacttagctttttcaagatttatcttttatgatcaacctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37118676 |
atgctcttataactcttcgtagaagaga-tttttttttctacctagattcaagttcatga-----ctttttcaagatttatcttttatgatcaacctttt |
37118583 |
T |
|
| Q |
201 |
gcaatctcttttccatgaacctaacatccatttttctattcaatatgagattcttatctacacaaaaataatcccccctcctctcaaatgtgagctcatc |
300 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37118582 |
gcaa-------tccatgaacctaacatccatttttctattcaatatgagattcttacctacacaaaaataatcccccctcctctcaaatgtgagc---tc |
37118493 |
T |
|
| Q |
301 |
tattcattttggattactctctttcgagtaaaagttttttatccacacac |
350 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
37118492 |
tattcattttggattaccctctttcaagtaaaagttttttatccacacac |
37118443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University