View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8460_low_6 (Length: 322)
Name: NF8460_low_6
Description: NF8460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8460_low_6 |
 |  |
|
| [»] scaffold0196 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 16344383 - 16344133
Alignment:
| Q |
16 |
aatcttttcatgtttggagaatgattcataacaaaatgccaacatatgacaaccttcagcgcaaagggctctctttcccatcaatgtgcagtttatgtgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16344383 |
aatcttttcatgtttggagaatgattcataacaaaatgccaacatatgacaaccttcagcgcaaagggctctctttcccatcaatgtgcagtttatgtgg |
16344284 |
T |
 |
| Q |
116 |
catgcagtctgaaacctcgcatcatttattccttcaaagttctttctctccgaccttatcgaactggcttacaaatataatcagcatgaacatcaacctt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16344283 |
catgcagtctgaaacctcgcatcatttattccttcaatgttctttctctctgaccttatggaactggcttacaaatataatcaacatgaacatcaacctt |
16344184 |
T |
 |
| Q |
216 |
acctcagtgctaaccattttagatacttgcaagagaggatgaagtcctcaa |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16344183 |
acctcagtgctaaccattttagatacttgcaagagaggatggagtcctcaa |
16344133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0196
Description:
Target: scaffold0196; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 16 - 103
Target Start/End: Original strand, 29944 - 30031
Alignment:
| Q |
16 |
aatcttttcatgtttggagaatgattcataacaaaatgccaacatatgacaaccttcagcgcaaagggctctctttcccatcaatgtg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||| |||| || ||||||| || ||| | ||||||||||||||||| |
|
|
| T |
29944 |
aatcttttcatgtttggagaatgattcacaacaagatgccaactgatgaaaatcttcagctcagaggtttatctttcccatcaatgtg |
30031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University