View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8460_low_7 (Length: 320)
Name: NF8460_low_7
Description: NF8460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8460_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 9 - 163
Target Start/End: Original strand, 29487534 - 29487688
Alignment:
| Q |
9 |
agcagagagttgtggtggacgggacgatttatcggttgtcacgatgatactctttttctataatttagtttcgtgttcgcatgcagatgcgttgaattgt |
108 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
29487534 |
agcagagagttgtggtggacgggtcgatttatcggttgtcacgatgatactctttttttataatttagtttcgtgttcgtatgttgatgcgttgaattgt |
29487633 |
T |
|
| Q |
109 |
gcacgtgatgtgtgattgttcgccttattttagatttgactctctactcttcaag |
163 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
29487634 |
gcacgtgacgtgtgattgttcgccttattttggatttgactctctacccttcaag |
29487688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 252 - 312
Target Start/End: Original strand, 29487777 - 29487837
Alignment:
| Q |
252 |
tatttgtttcttggttacaaaatttatggttgggattaaattttctaggaatatgatgatg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
29487777 |
tatttgtttcttggttacaaaatttatggtcgggattaaattttttaggaatatgatgatg |
29487837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University