View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8461_high_8 (Length: 242)
Name: NF8461_high_8
Description: NF8461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8461_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 51755677 - 51755896
Alignment:
| Q |
4 |
agaaaattctccacttgacactctagctttcaactacttgagcttcgatttcttcaaccatttatggacatggctcgccgtaatcttctggaggatccca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51755677 |
agaaaattctccacttgacactctagctttcaactacttgagcttcgatttcttcaaccatttatggacatggctcgccgtcatcttctggaggatccca |
51755776 |
T |
 |
| Q |
104 |
acccctaaacctgaattgttacctccttcccacgacacttcctccgataaacctcacctaggtctggaagtgttggaacctcgtcatgatgatgcttgtc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51755777 |
acccctaaacctgaattgttacctccttcccacgacacttcctccgataaacctcacctaggtctggaagtgttggaacctcgtcatgattatgcttgtc |
51755876 |
T |
 |
| Q |
204 |
cagcgcgtgttcctagtaac |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51755877 |
cagcgcgtgttcctagtaac |
51755896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University