View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8461_low_13 (Length: 207)
Name: NF8461_low_13
Description: NF8461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8461_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 189
Target Start/End: Complemental strand, 52806548 - 52806367
Alignment:
| Q |
8 |
gagaagcagagagaaaacattaaccttagcagtttcagacagaacaatttcatggctgctactagtgttaagcacagttcttctgagtttaactcagttc |
107 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52806548 |
gagaatcatagagaaaacattaaccttagcagtttcagacagaacaatttcatggctgctactagtgctaagcacagttcttctgagtttaactcagttc |
52806449 |
T |
 |
| Q |
108 |
tcttttctccaccaaaaagaaccgagttgatgagtacatcaggtggacttggcttgacccttcattcttccaggtgatattt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52806448 |
tcttttctccaccaaaaagaaccgagttgatgagtacatcaggtggacttggcttgacccttcattcttccaggtgatattt |
52806367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University