View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8461_low_5 (Length: 253)
Name: NF8461_low_5
Description: NF8461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8461_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 11 - 211
Target Start/End: Complemental strand, 25362840 - 25362650
Alignment:
| Q |
11 |
ttggtgttatgttaagattgattttttggggttaaattgctagtatgatttggtattgtcttgagtgtgaaaaatggtgtggaagtcaacaaaaaatgtt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25362840 |
ttggtgttatgttaagattgattttttggggttaaattgct----------ggtattgtcttgagtgtgaaaaatggtgtggaagtcaacaaaatatgtt |
25362751 |
T |
 |
| Q |
111 |
cacactaggatgatttgttcctgttctcctccttttcataaatcaaactaaagtttatatcatgaaatttatatattaaaagtcactataatgtacaatt |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25362750 |
tacactaggatgatttgttcatgttctcctccttttcataaatcaaactaaagtttatatcatgaaatttatatattaaaagtaactataatgtacaatt |
25362651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University