View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8461_low_8 (Length: 243)
Name: NF8461_low_8
Description: NF8461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8461_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 13 - 192
Target Start/End: Original strand, 43910807 - 43910989
Alignment:
| Q |
13 |
tttggtgttatatattccatctgtagcctgttnnnnnnn-tacaaattccctagaaaa-aataatcaatgtcttatatttttctaaaatgacttattatt |
110 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43910807 |
tttggtgttatatattccatctttagcttgttaaaaaaaatacaaattccctaaaaaaaaataatcaatgtcttatatttttctaaaatgacttattatt |
43910906 |
T |
|
| Q |
111 |
tattataaaagaaaatgcatgtg-nnnnnnnnagggaaaaatgcatatgtgttgacatgcacgagatgtttgttgtcttttaa |
192 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43910907 |
tattataaaagaaaatgcatgtgtttttttttagggaaaaatgcatatgtgttgacatgcacgagatgtttgttgtcttttaa |
43910989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University