View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8463_high_14 (Length: 337)
Name: NF8463_high_14
Description: NF8463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8463_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 10 - 287
Target Start/End: Complemental strand, 30621714 - 30621441
Alignment:
| Q |
10 |
ggtgttgagacttgatgccagaccagtnnnnnnnnnnnggagaataagtagggaggcagaagcatattcttctcgaatatttgcacttgcagtaactgta |
109 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30621714 |
ggtgttgagatttgatgccagaccagtaaaaaaaaataggagaataattagggaggcagaagcatattcttctcgaatatttgcactttcagtaactgta |
30621615 |
T |
|
| Q |
110 |
attttcctttgccaataaaatttcttcttttgcctatatatcattttccactgcctttaannnnnnnnncactaaagccaaatcctttgattcatctttt |
209 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||| | |||||||||||| | |||| ||||||||||| |
|
|
| T |
30621614 |
attttcctttgccaatgaaattttttctttttcctatatatcattttccactgcctttcatttttttttcactaaagccaatttcttttattcatctttt |
30621515 |
T |
|
| Q |
210 |
tctttctctctcttgtagttccaacgacttctgtgttaattatctttcaggtaacaatcttgcattctcactttctac |
287 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
30621514 |
tctttctctctcttgtagttcca---acttctgtgttaattatc-ttcaggtaacaatcttgcattctcactatctac |
30621441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University