View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8463_high_19 (Length: 240)
Name: NF8463_high_19
Description: NF8463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8463_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 40404361 - 40404588
Alignment:
| Q |
1 |
tctcaccattgtaagtaaccattttgttttcttgtaaattaattgaacaaagtgaagtga-----taatttcctaaacgnnnnnnnnnnnnnnnnnnntt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| || |
|
|
| T |
40404361 |
tctcaccattgtaagtaaccattttgttttcttgtaaattaattgaacaaagtgaagtgaagtgataatttactaaacgtatatatat----------tt |
40404450 |
T |
|
| Q |
96 |
gcaggccaactttttacgtaatcttcaagaagaaatctgctgaaggatttcaggcacttccttatgttgtggcacttttcagtgcaatgctttggatcta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40404451 |
gcaggccaactttttacgtaatcttcaagaagaaatctgctgaaggatttcaggcacttccttatgttgtggcacttttcagtgcaatgctttggatcta |
40404550 |
T |
|
| Q |
196 |
ctatgcatttgtcaaaagagaatctgctcttcttctca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40404551 |
ctatgcatttgtcaaaagagaatctgctcttcttctca |
40404588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 212
Target Start/End: Original strand, 45317632 - 45317749
Alignment:
| Q |
95 |
tgcaggccaactttttacgtaatcttcaagaagaaatctgctgaaggatttcaggcacttccttatgttgtggcacttttcagtgcaatgctttggatct |
194 |
Q |
| |
|
||||| ||||| |||||| ||||| ||||||||||||| ||||||| ||||| || ||||||||||| ||| | || ||||||||||||||||||| |
|
|
| T |
45317632 |
tgcagaccaacattttaccgaatctacaagaagaaatctactgaagggtttcaatcagttccttatgttactgcattgttgagtgcaatgctttggatct |
45317731 |
T |
|
| Q |
195 |
actatgcatttgtcaaaa |
212 |
Q |
| |
|
| |||||| |||||||| |
|
|
| T |
45317732 |
attatgcacatgtcaaaa |
45317749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University