View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8463_high_20 (Length: 239)
Name: NF8463_high_20
Description: NF8463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8463_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 12187776 - 12187990
Alignment:
| Q |
20 |
ctttcctctttacctagattcatgctgtaaaa-gttacacacaccc--tcattccatcaaactaatcttaaacgaccctgatacctttcacctttccgat |
116 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12187776 |
ctttcttctttacctagattaatgctttaaaaagttacacacaccccctcattccaccaaactaatcttaaacgaccctgatacctttcacctttcagat |
12187875 |
T |
 |
| Q |
117 |
gataattttagaattaaagtcttatgtacatcatgatatttacatgccctgagtttcatgtaagcacttgtgcaccgaaagttaattaaaattcttgtca |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12187876 |
gataattttagaattaaagacttatgtacatcatgatatttacatgccctgagtttcaagtaagcacttgtgcaccgaaagttaattaaaattcttgtca |
12187975 |
T |
 |
| Q |
217 |
tcatcgttcttctca |
231 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
12187976 |
tcatcgtccttctca |
12187990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University